Review



rabbit anti ezh2  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Cell Signaling Technology Inc rabbit anti ezh2
    Rabbit Anti Ezh2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1127 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5246s/Ezh2+XP+Rabbit+mAb/pm41888115-297-35-41
    Average 96 stars, based on 1127 article reviews
    rabbit anti ezh2 - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Strep-tag:

    Article Title: Nucleosomal asymmetry shapes histone mark binding and promotes poising at bivalent domains.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies TAF3 abcam Cat# ab188332; lot GR220332-3; RRID:AB_3669116 ING2 abcam Cat# ab109594; lot YH102514; RRID:AB_10861249 PHF2 Cell Signaling Cat# 3497S; lot 2; RRID:AB_1904085 ASH2L Cell Signaling Cat# 5019S; lot 1; RRID:AB_1950350 SPIN1 Cell Signaling Cat# 89139S; lot 1; RRID:AB_3669115 CBX7 Millipore Cat# 07-981; lot 3319462; RRID:AB_10807034 CBX7 abcam Cat# ab21873; lots GR3210651-1 and 2; RRID:AB_726005 EZH2 BD Biosciences Cat# 612667; lot 415817; RRID:AB_399911 EZH2 Cell Signaling Cat# 5246S; lot 9; RRID:AB_10694683 RING1B Cell Signaling Cat# 5694S; lot 3; RRID:AB_10705604 HA tag abcam Cat# ab9110; lot GR3199553-1; RRID:AB_307019 HA tag Cell Signaling Cat# 3724S; lot 9; RRID:AB_1549585 BRPF1 abcam Cat# ab259840; lot GR3394616-5; RRID:AB_3669117 BRPF2 abcam Cat# ab71877; lot GR3326941-1; RRID:AB_1603765 ING5 abcam Cat# ab96851; lot GR27439-12; RRID:AB_10680089 SRCAP kerafast Cat# ESL104; RRID:AB_3669119 DMAP1 Cell Signaling Cat# 13326S; lot 1; RRID:AB_2798180 GAS41 Invitrogen Cat# PA5-34867; lot WD3254237D; RRID:AB_2552219 H4 Cell Signaling Cat# 13919; lot 3; RRID:AB_2798345 H3K4me3 Cell Signaling Cat# 9751; lot 10; RRID:AB_2616028 H3K4me3 abcam Cat# ab8580; lot GR273043-2; RRID:AB_306649 H3K27me3 Cell Signaling Cat# 9733; lot 8 and 14; RRID:AB_2616029 H3K9me2/3 Cell Signaling Cat# 5327S; lot 1; RRID:AB_10695295 H3K9ac abcam Cat# ab4441; lot GR3279479-1; RRID:AB_2118292 H3K23ac abcam Cat# ab177275; lot GR3213108-2; RRID:AB_2927706 H3K14ac abcam Cat# ab52946; lot GR3252548-2; RRID:AB_880442 Histone H2Av Active Motif Cat# 61686; lot 10618006; RRID:AB_2737370 His tag Sigma Cat# H1029; lot 033m4785; RRID:AB_260015 Strep tag IBA Cat# 2-150-7001; RRID:AB_513133 (Continued on next page) e1 Molecular Cell 85, 1–19.e1–e12, February 6, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER KAT6B/MORF abcam Cat# ab191994; lot GR3180184; RRID:AB_3669118 b-tubulin abcam Cat# ab6046; lot GR3243627-1; RRID:AB_2210370 POU5F1 (OCT4) Sigma Cat# P0056; lot 118K4779; RRID:AB_1841114 Beta III-tubulin (Tuj1) abcam Cat# ab18207; lot GR3196636-1; RRID:AB_444319 Peroxidase AffiniPure Donkey Anti-Rabbit IgG (H+L) Jackson ImmunoResearch Cat# 711-035-152; RRID:AB_10015282 Peroxidase AffiniPure Donkey Anti-Mouse IgG (H+L) Jackson ImmunoResearch Cat# 715-035-150; RRID:AB_2340770 Alexa Fluor 488 Donkey anti-Mouse IgG Invitrogen Cat# A21202; lot 1915874; RRID:AB_141607 Alexa Fluor 555 Donkey anti-Rabbit IgG Invitrogen Cat# A31572; lot 1917920; RRID:AB_162543 Bacterial and virus strains XL10-Gold ultracompetent cells Agilent Cat# AGLS200314 BL21 (DE3) Invitrogen Cat# C600003 BL21 (DE3) pLysS Promega Cat# L1195 Biological samples See below for cell lines N/A N/A Chemicals, peptides, and recombinant proteins Gelatin 20% solution Sigma Cat# G1393-100ML Lipofectamine 2000 Invitrogen Cat# 11668019 Lipofectamine 3000 Invitrogen Cat# L3000001 DMEM (4.5 g/l glucose) Gibco Cat# 41965062 I-glutamine Gibco Cat# 25030024 Pyruvate Gibco Cat# 11360088 MEM nonessential amino acids Gibco Cat# 11140035 Penicillin streptomycin Gibco Cat# 15140122 0.05% Trypsin-EDTA Gibco Cat# 25300062 PBS Gibco Cat# 70013065 Fetal Bovine Serum Gibco Cat# A3160802 2-Mercaptoethanol Sigma Cat# 31350-010 Leukaemia inhibitory factor (LIF) Produced in-house N/A QuickExtract DNA extraction solution Epicentre Cat# QE08050 Trypan Blue Gibco Cat# T10282 Vivacon 500 30 kDa MWCO spin columns Sartorius Cat# VN01H21 Iodoacetamide Sigma Cat# I1149 Pierce Trypsin, Mass Spectrometry Grade ThermoFisher Cat# 90057 HiTrap Q HP columns 5 ml Cytiva Cat# 17115401 HiTrap Q HP columns 1 ml Cytiva Cat# 17115301 HiTrap SP HP columns 5 ml Cytiva Cat# 17115201 HiTrap SP HP columns 1 ml Cytiva Cat# 17115101 Custom-made thioester peptides Peptide Protein Research Ltd. N/A TCEP Sigma Cat# C4706 4-mercaptophenylacetic acid Sigma Cat# 653152 Superdex 200 10/300 GL column GE Healthcare Cat# 17-5175-01 (Continued on next page) Molecular Cell 85, 1–19.e1–e12, February 6, 2025 e2

    Data-independent acquisition:

    Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal IkBa Cell Signaling Technology Cat# 4814S; RRID: AB_390781 Mouse monoclonal b-Actin Cell Signaling Technology Cat# 3700; RRID: AB_2242334 Rabbit monoclonal Tri-Methyl-Histone H3(Lys27) Cell Signaling Technology Cat# 9733S; RRID: AB_2616029 Mouse monoclonal Di/Tri-Methyl-histone H3 (Lys9) Cell Signaling Technology Cat# 5327S; RRID: AB_10695295 Mouse monoclonal Anti-5-methylcytosine (5-mC) Abcam Cat# ab10805; RRID: AB_442823 Rabbit monoclonal Ezh2 Cell Signaling Technology Cat# 5246S; RRID: AB_10694683 Mouse monoclonal Anti-IDH1 R132H Dianova manufacture Cat# DIA-H09; RRID: AB_2335716 Mouse monoclonal PP1 (E 9) Santa Cruz Cat# 7482; RRID: AB_628177 Mouse monoclonal Phospho IkBa Cell signaling Cat# 9246; RRID: AB_22267145 Mouse monoclonal Anti-a-Tubulin Sigma Aldrich Cat# T6074; RRID:AB_477582 Rabbit monoclonal Anti-Histone H3 Abcam Cat# ab1791; RRID: AB_302613 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat# 7076; RRID:AB_330924 Anti-rabbit IgG, HRP-Linked Antibody Cell Signaling Cat# 7074; RRID:AB_2099233 Donkey anti-mouse IgG (H + L) Alexa FluorTM 594 Thermo Fisher/Invitrogen Cat# R37115; RRID:AB_2556543 Bacterial and virus strains Retroviral vector pLNCX2 Turcan et al.13 N/A Biological samples Diffuse glioma samples (Populations 1–7) This study Table S1 Chemicals, peptides, and recombinant proteins Plasmid Transfection Medium Santa Cruz Cat# sc-108062 Ultra-Cruz Transfection Reagent Santa Cruz Cat# sc-395739 Gibco Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL) Gibco Cat# 10131-027 TRIzol Reagent Invitrogen Cat# 15-596-018 Gibco Opti-MEM I Reduced Serum Medium, no phenol red Gibco Cat# 11-058-021 Lipofectamine 2000 Transfection Reagent Invitrogen Cat# 11668019 GenomicDNA MiniPrep Kit Sigma Aldrich Cat# G1N70-1KT Critical commercial assays TransAM NF-kB Activation Assays | Colorimetric Kits Active Motif Cat# 43296 Nuclear Extract Kit Active Motif Cat# 40010 EpiQuik Global Histone H3K27 Methylation Assay Kit Epigentek Cat# P-3020-96 D-2-Hydroxyglutarate Assay Kit (Colorimetric) Abcam Cat# ab211070 GenElute Genomic DNA miniprep kit Sigma Aldrich Cat# GN170 Deposited data Clinical, genetic marker data (Populations 1–7) This study Table S2 ChIP-sequencing data This study GEO accession # GSE222571 (Continued on next page) Cell Reports Medicine 4, 101082, June 20, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNA-sequencing data This study portal.gdc.cancer.gov RNA-sequencing data This study GEO accession #GSE223712 RNA-sequencing data Nagaraja et al.17 GEO accession #GSE126319 RNA-sequencing data Grasso et al.70 dbGaP study accession phs000900.v1.p1 DNA methylation data This study portal.gdc.cancer.gov DNA methylation signature raw data – RTOG 9802 This study Table S6 NFKBIA methylation raw data – RTOG 9802 This study Table S6 DNA methylation data De Souza et al.16 https://data.mendeley.com/datasets/ hx566mwxnm/ DNA methylation data Mazor et al.78 EGAS00001001255 DNA methylation data Mazor et al.79 EGAS00001001854 DNA methylation data Bai et al.80 EGAS00001001588 DNA copy number variation data This study portal.gdc.cancer.gov NFKBIA DNA CNV raw data – RTOG 9802 This study Table S6 NFKBIA DNA CNV raw data – Mayo This study Table S6 DNA copy number variation data Suzuki et al.3 EGAS00001001044 Sequencing data This study portal.gdc.cancer.gov NFKBIA sequencing raw data This study https://github.com/SharedExomes/ Prim_Recur_Glioma_NFKBIA_exomes Experimental models: Cell lines NHA (Normal human immortalized astrocytes) Parental Sonoda et al.81 N/A NHA IDH1 WT Turcan et al.13 N/A NHA IDH1 R132H Turcan et al.13 N/A NHA IDH1 WT/KO IkBa This study N/A NHA IDH1 R132H Mut/KO IkBa This study N/A Oligonucleotides Accell Human NFKBIA siRNA Dharmacon (Horizon) Cat# A-004765-13-0020 Accell Non-targeting Control siRNA Dharmacon (Horizon) Cat# D-001910-01-20 Primer: SLC16A3 Forward: ACGAAAAGTGGGTTGGTCAG Invitrogen Cat# custome Primer: SLC16A3 Reverse: CCCCAACAGACACAAGACCT Invitrogen Cat# custome Recombinant DNA IkB-a Double Nickase Plasmid (h) Santa Cruz Cat# sc-400034-NIC NFKBIA FISH probe Empire Genomics Cat# NFKBIA-20-OR Software and algorithms R The R project for Statistical Computing https://www.r-project.org/ R package DNAcopy 1.72.3 Olshen et al.82 https://bioconductor.org/packages/ release/bioc/html/DNAcopy.html R package conumee 1.9.0 N/A https://bioconductor.org/packages/ release/bioc/html/conumee.html R package RCircos 1.2.2 Zhang et al.83 https://cran.r-project.org/web/packages/ RCircos/index.html R package minifi 1.44.0 Aryee et al.84 https://www.bioconductor.org/packages/ release/bioc/html/minfi.html R package TCGAbiolinksGUI 1.23.0 https://www.biorxiv.org/ content/10.1101/147496v2.full https://www.bioconductor.org/packages/ release/bioc/html/TCGAbiolinksGUI.html (Continued on next page) e2 Cell Reports Medicine 4, 101082, June 20, 2023

    Virus:

    Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal IkBa Cell Signaling Technology Cat# 4814S; RRID: AB_390781 Mouse monoclonal b-Actin Cell Signaling Technology Cat# 3700; RRID: AB_2242334 Rabbit monoclonal Tri-Methyl-Histone H3(Lys27) Cell Signaling Technology Cat# 9733S; RRID: AB_2616029 Mouse monoclonal Di/Tri-Methyl-histone H3 (Lys9) Cell Signaling Technology Cat# 5327S; RRID: AB_10695295 Mouse monoclonal Anti-5-methylcytosine (5-mC) Abcam Cat# ab10805; RRID: AB_442823 Rabbit monoclonal Ezh2 Cell Signaling Technology Cat# 5246S; RRID: AB_10694683 Mouse monoclonal Anti-IDH1 R132H Dianova manufacture Cat# DIA-H09; RRID: AB_2335716 Mouse monoclonal PP1 (E 9) Santa Cruz Cat# 7482; RRID: AB_628177 Mouse monoclonal Phospho IkBa Cell signaling Cat# 9246; RRID: AB_22267145 Mouse monoclonal Anti-a-Tubulin Sigma Aldrich Cat# T6074; RRID:AB_477582 Rabbit monoclonal Anti-Histone H3 Abcam Cat# ab1791; RRID: AB_302613 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat# 7076; RRID:AB_330924 Anti-rabbit IgG, HRP-Linked Antibody Cell Signaling Cat# 7074; RRID:AB_2099233 Donkey anti-mouse IgG (H + L) Alexa FluorTM 594 Thermo Fisher/Invitrogen Cat# R37115; RRID:AB_2556543 Bacterial and virus strains Retroviral vector pLNCX2 Turcan et al.13 N/A Biological samples Diffuse glioma samples (Populations 1–7) This study Table S1 Chemicals, peptides, and recombinant proteins Plasmid Transfection Medium Santa Cruz Cat# sc-108062 Ultra-Cruz Transfection Reagent Santa Cruz Cat# sc-395739 Gibco Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL) Gibco Cat# 10131-027 TRIzol Reagent Invitrogen Cat# 15-596-018 Gibco Opti-MEM I Reduced Serum Medium, no phenol red Gibco Cat# 11-058-021 Lipofectamine 2000 Transfection Reagent Invitrogen Cat# 11668019 GenomicDNA MiniPrep Kit Sigma Aldrich Cat# G1N70-1KT Critical commercial assays TransAM NF-kB Activation Assays | Colorimetric Kits Active Motif Cat# 43296 Nuclear Extract Kit Active Motif Cat# 40010 EpiQuik Global Histone H3K27 Methylation Assay Kit Epigentek Cat# P-3020-96 D-2-Hydroxyglutarate Assay Kit (Colorimetric) Abcam Cat# ab211070 GenElute Genomic DNA miniprep kit Sigma Aldrich Cat# GN170 Deposited data Clinical, genetic marker data (Populations 1–7) This study Table S2 ChIP-sequencing data This study GEO accession # GSE222571 (Continued on next page) Cell Reports Medicine 4, 101082, June 20, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNA-sequencing data This study portal.gdc.cancer.gov RNA-sequencing data This study GEO accession #GSE223712 RNA-sequencing data Nagaraja et al.17 GEO accession #GSE126319 RNA-sequencing data Grasso et al.70 dbGaP study accession phs000900.v1.p1 DNA methylation data This study portal.gdc.cancer.gov DNA methylation signature raw data – RTOG 9802 This study Table S6 NFKBIA methylation raw data – RTOG 9802 This study Table S6 DNA methylation data De Souza et al.16 https://data.mendeley.com/datasets/ hx566mwxnm/ DNA methylation data Mazor et al.78 EGAS00001001255 DNA methylation data Mazor et al.79 EGAS00001001854 DNA methylation data Bai et al.80 EGAS00001001588 DNA copy number variation data This study portal.gdc.cancer.gov NFKBIA DNA CNV raw data – RTOG 9802 This study Table S6 NFKBIA DNA CNV raw data – Mayo This study Table S6 DNA copy number variation data Suzuki et al.3 EGAS00001001044 Sequencing data This study portal.gdc.cancer.gov NFKBIA sequencing raw data This study https://github.com/SharedExomes/ Prim_Recur_Glioma_NFKBIA_exomes Experimental models: Cell lines NHA (Normal human immortalized astrocytes) Parental Sonoda et al.81 N/A NHA IDH1 WT Turcan et al.13 N/A NHA IDH1 R132H Turcan et al.13 N/A NHA IDH1 WT/KO IkBa This study N/A NHA IDH1 R132H Mut/KO IkBa This study N/A Oligonucleotides Accell Human NFKBIA siRNA Dharmacon (Horizon) Cat# A-004765-13-0020 Accell Non-targeting Control siRNA Dharmacon (Horizon) Cat# D-001910-01-20 Primer: SLC16A3 Forward: ACGAAAAGTGGGTTGGTCAG Invitrogen Cat# custome Primer: SLC16A3 Reverse: CCCCAACAGACACAAGACCT Invitrogen Cat# custome Recombinant DNA IkB-a Double Nickase Plasmid (h) Santa Cruz Cat# sc-400034-NIC NFKBIA FISH probe Empire Genomics Cat# NFKBIA-20-OR Software and algorithms R The R project for Statistical Computing https://www.r-project.org/ R package DNAcopy 1.72.3 Olshen et al.82 https://bioconductor.org/packages/ release/bioc/html/DNAcopy.html R package conumee 1.9.0 N/A https://bioconductor.org/packages/ release/bioc/html/conumee.html R package RCircos 1.2.2 Zhang et al.83 https://cran.r-project.org/web/packages/ RCircos/index.html R package minifi 1.44.0 Aryee et al.84 https://www.bioconductor.org/packages/ release/bioc/html/minfi.html R package TCGAbiolinksGUI 1.23.0 https://www.biorxiv.org/ content/10.1101/147496v2.full https://www.bioconductor.org/packages/ release/bioc/html/TCGAbiolinksGUI.html (Continued on next page) e2 Cell Reports Medicine 4, 101082, June 20, 2023

    Retroviral:

    Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal IkBa Cell Signaling Technology Cat# 4814S; RRID: AB_390781 Mouse monoclonal b-Actin Cell Signaling Technology Cat# 3700; RRID: AB_2242334 Rabbit monoclonal Tri-Methyl-Histone H3(Lys27) Cell Signaling Technology Cat# 9733S; RRID: AB_2616029 Mouse monoclonal Di/Tri-Methyl-histone H3 (Lys9) Cell Signaling Technology Cat# 5327S; RRID: AB_10695295 Mouse monoclonal Anti-5-methylcytosine (5-mC) Abcam Cat# ab10805; RRID: AB_442823 Rabbit monoclonal Ezh2 Cell Signaling Technology Cat# 5246S; RRID: AB_10694683 Mouse monoclonal Anti-IDH1 R132H Dianova manufacture Cat# DIA-H09; RRID: AB_2335716 Mouse monoclonal PP1 (E 9) Santa Cruz Cat# 7482; RRID: AB_628177 Mouse monoclonal Phospho IkBa Cell signaling Cat# 9246; RRID: AB_22267145 Mouse monoclonal Anti-a-Tubulin Sigma Aldrich Cat# T6074; RRID:AB_477582 Rabbit monoclonal Anti-Histone H3 Abcam Cat# ab1791; RRID: AB_302613 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat# 7076; RRID:AB_330924 Anti-rabbit IgG, HRP-Linked Antibody Cell Signaling Cat# 7074; RRID:AB_2099233 Donkey anti-mouse IgG (H + L) Alexa FluorTM 594 Thermo Fisher/Invitrogen Cat# R37115; RRID:AB_2556543 Bacterial and virus strains Retroviral vector pLNCX2 Turcan et al.13 N/A Biological samples Diffuse glioma samples (Populations 1–7) This study Table S1 Chemicals, peptides, and recombinant proteins Plasmid Transfection Medium Santa Cruz Cat# sc-108062 Ultra-Cruz Transfection Reagent Santa Cruz Cat# sc-395739 Gibco Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL) Gibco Cat# 10131-027 TRIzol Reagent Invitrogen Cat# 15-596-018 Gibco Opti-MEM I Reduced Serum Medium, no phenol red Gibco Cat# 11-058-021 Lipofectamine 2000 Transfection Reagent Invitrogen Cat# 11668019 GenomicDNA MiniPrep Kit Sigma Aldrich Cat# G1N70-1KT Critical commercial assays TransAM NF-kB Activation Assays | Colorimetric Kits Active Motif Cat# 43296 Nuclear Extract Kit Active Motif Cat# 40010 EpiQuik Global Histone H3K27 Methylation Assay Kit Epigentek Cat# P-3020-96 D-2-Hydroxyglutarate Assay Kit (Colorimetric) Abcam Cat# ab211070 GenElute Genomic DNA miniprep kit Sigma Aldrich Cat# GN170 Deposited data Clinical, genetic marker data (Populations 1–7) This study Table S2 ChIP-sequencing data This study GEO accession # GSE222571 (Continued on next page) Cell Reports Medicine 4, 101082, June 20, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNA-sequencing data This study portal.gdc.cancer.gov RNA-sequencing data This study GEO accession #GSE223712 RNA-sequencing data Nagaraja et al.17 GEO accession #GSE126319 RNA-sequencing data Grasso et al.70 dbGaP study accession phs000900.v1.p1 DNA methylation data This study portal.gdc.cancer.gov DNA methylation signature raw data – RTOG 9802 This study Table S6 NFKBIA methylation raw data – RTOG 9802 This study Table S6 DNA methylation data De Souza et al.16 https://data.mendeley.com/datasets/ hx566mwxnm/ DNA methylation data Mazor et al.78 EGAS00001001255 DNA methylation data Mazor et al.79 EGAS00001001854 DNA methylation data Bai et al.80 EGAS00001001588 DNA copy number variation data This study portal.gdc.cancer.gov NFKBIA DNA CNV raw data – RTOG 9802 This study Table S6 NFKBIA DNA CNV raw data – Mayo This study Table S6 DNA copy number variation data Suzuki et al.3 EGAS00001001044 Sequencing data This study portal.gdc.cancer.gov NFKBIA sequencing raw data This study https://github.com/SharedExomes/ Prim_Recur_Glioma_NFKBIA_exomes Experimental models: Cell lines NHA (Normal human immortalized astrocytes) Parental Sonoda et al.81 N/A NHA IDH1 WT Turcan et al.13 N/A NHA IDH1 R132H Turcan et al.13 N/A NHA IDH1 WT/KO IkBa This study N/A NHA IDH1 R132H Mut/KO IkBa This study N/A Oligonucleotides Accell Human NFKBIA siRNA Dharmacon (Horizon) Cat# A-004765-13-0020 Accell Non-targeting Control siRNA Dharmacon (Horizon) Cat# D-001910-01-20 Primer: SLC16A3 Forward: ACGAAAAGTGGGTTGGTCAG Invitrogen Cat# custome Primer: SLC16A3 Reverse: CCCCAACAGACACAAGACCT Invitrogen Cat# custome Recombinant DNA IkB-a Double Nickase Plasmid (h) Santa Cruz Cat# sc-400034-NIC NFKBIA FISH probe Empire Genomics Cat# NFKBIA-20-OR Software and algorithms R The R project for Statistical Computing https://www.r-project.org/ R package DNAcopy 1.72.3 Olshen et al.82 https://bioconductor.org/packages/ release/bioc/html/DNAcopy.html R package conumee 1.9.0 N/A https://bioconductor.org/packages/ release/bioc/html/conumee.html R package RCircos 1.2.2 Zhang et al.83 https://cran.r-project.org/web/packages/ RCircos/index.html R package minifi 1.44.0 Aryee et al.84 https://www.bioconductor.org/packages/ release/bioc/html/minfi.html R package TCGAbiolinksGUI 1.23.0 https://www.biorxiv.org/ content/10.1101/147496v2.full https://www.bioconductor.org/packages/ release/bioc/html/TCGAbiolinksGUI.html (Continued on next page) e2 Cell Reports Medicine 4, 101082, June 20, 2023

    Plasmid Preparation:

    Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal IkBa Cell Signaling Technology Cat# 4814S; RRID: AB_390781 Mouse monoclonal b-Actin Cell Signaling Technology Cat# 3700; RRID: AB_2242334 Rabbit monoclonal Tri-Methyl-Histone H3(Lys27) Cell Signaling Technology Cat# 9733S; RRID: AB_2616029 Mouse monoclonal Di/Tri-Methyl-histone H3 (Lys9) Cell Signaling Technology Cat# 5327S; RRID: AB_10695295 Mouse monoclonal Anti-5-methylcytosine (5-mC) Abcam Cat# ab10805; RRID: AB_442823 Rabbit monoclonal Ezh2 Cell Signaling Technology Cat# 5246S; RRID: AB_10694683 Mouse monoclonal Anti-IDH1 R132H Dianova manufacture Cat# DIA-H09; RRID: AB_2335716 Mouse monoclonal PP1 (E 9) Santa Cruz Cat# 7482; RRID: AB_628177 Mouse monoclonal Phospho IkBa Cell signaling Cat# 9246; RRID: AB_22267145 Mouse monoclonal Anti-a-Tubulin Sigma Aldrich Cat# T6074; RRID:AB_477582 Rabbit monoclonal Anti-Histone H3 Abcam Cat# ab1791; RRID: AB_302613 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat# 7076; RRID:AB_330924 Anti-rabbit IgG, HRP-Linked Antibody Cell Signaling Cat# 7074; RRID:AB_2099233 Donkey anti-mouse IgG (H + L) Alexa FluorTM 594 Thermo Fisher/Invitrogen Cat# R37115; RRID:AB_2556543 Bacterial and virus strains Retroviral vector pLNCX2 Turcan et al.13 N/A Biological samples Diffuse glioma samples (Populations 1–7) This study Table S1 Chemicals, peptides, and recombinant proteins Plasmid Transfection Medium Santa Cruz Cat# sc-108062 Ultra-Cruz Transfection Reagent Santa Cruz Cat# sc-395739 Gibco Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL) Gibco Cat# 10131-027 TRIzol Reagent Invitrogen Cat# 15-596-018 Gibco Opti-MEM I Reduced Serum Medium, no phenol red Gibco Cat# 11-058-021 Lipofectamine 2000 Transfection Reagent Invitrogen Cat# 11668019 GenomicDNA MiniPrep Kit Sigma Aldrich Cat# G1N70-1KT Critical commercial assays TransAM NF-kB Activation Assays | Colorimetric Kits Active Motif Cat# 43296 Nuclear Extract Kit Active Motif Cat# 40010 EpiQuik Global Histone H3K27 Methylation Assay Kit Epigentek Cat# P-3020-96 D-2-Hydroxyglutarate Assay Kit (Colorimetric) Abcam Cat# ab211070 GenElute Genomic DNA miniprep kit Sigma Aldrich Cat# GN170 Deposited data Clinical, genetic marker data (Populations 1–7) This study Table S2 ChIP-sequencing data This study GEO accession # GSE222571 (Continued on next page) Cell Reports Medicine 4, 101082, June 20, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNA-sequencing data This study portal.gdc.cancer.gov RNA-sequencing data This study GEO accession #GSE223712 RNA-sequencing data Nagaraja et al.17 GEO accession #GSE126319 RNA-sequencing data Grasso et al.70 dbGaP study accession phs000900.v1.p1 DNA methylation data This study portal.gdc.cancer.gov DNA methylation signature raw data – RTOG 9802 This study Table S6 NFKBIA methylation raw data – RTOG 9802 This study Table S6 DNA methylation data De Souza et al.16 https://data.mendeley.com/datasets/ hx566mwxnm/ DNA methylation data Mazor et al.78 EGAS00001001255 DNA methylation data Mazor et al.79 EGAS00001001854 DNA methylation data Bai et al.80 EGAS00001001588 DNA copy number variation data This study portal.gdc.cancer.gov NFKBIA DNA CNV raw data – RTOG 9802 This study Table S6 NFKBIA DNA CNV raw data – Mayo This study Table S6 DNA copy number variation data Suzuki et al.3 EGAS00001001044 Sequencing data This study portal.gdc.cancer.gov NFKBIA sequencing raw data This study https://github.com/SharedExomes/ Prim_Recur_Glioma_NFKBIA_exomes Experimental models: Cell lines NHA (Normal human immortalized astrocytes) Parental Sonoda et al.81 N/A NHA IDH1 WT Turcan et al.13 N/A NHA IDH1 R132H Turcan et al.13 N/A NHA IDH1 WT/KO IkBa This study N/A NHA IDH1 R132H Mut/KO IkBa This study N/A Oligonucleotides Accell Human NFKBIA siRNA Dharmacon (Horizon) Cat# A-004765-13-0020 Accell Non-targeting Control siRNA Dharmacon (Horizon) Cat# D-001910-01-20 Primer: SLC16A3 Forward: ACGAAAAGTGGGTTGGTCAG Invitrogen Cat# custome Primer: SLC16A3 Reverse: CCCCAACAGACACAAGACCT Invitrogen Cat# custome Recombinant DNA IkB-a Double Nickase Plasmid (h) Santa Cruz Cat# sc-400034-NIC NFKBIA FISH probe Empire Genomics Cat# NFKBIA-20-OR Software and algorithms R The R project for Statistical Computing https://www.r-project.org/ R package DNAcopy 1.72.3 Olshen et al.82 https://bioconductor.org/packages/ release/bioc/html/DNAcopy.html R package conumee 1.9.0 N/A https://bioconductor.org/packages/ release/bioc/html/conumee.html R package RCircos 1.2.2 Zhang et al.83 https://cran.r-project.org/web/packages/ RCircos/index.html R package minifi 1.44.0 Aryee et al.84 https://www.bioconductor.org/packages/ release/bioc/html/minfi.html R package TCGAbiolinksGUI 1.23.0 https://www.biorxiv.org/ content/10.1101/147496v2.full https://www.bioconductor.org/packages/ release/bioc/html/TCGAbiolinksGUI.html (Continued on next page) e2 Cell Reports Medicine 4, 101082, June 20, 2023

    Recombinant:

    Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal IkBa Cell Signaling Technology Cat# 4814S; RRID: AB_390781 Mouse monoclonal b-Actin Cell Signaling Technology Cat# 3700; RRID: AB_2242334 Rabbit monoclonal Tri-Methyl-Histone H3(Lys27) Cell Signaling Technology Cat# 9733S; RRID: AB_2616029 Mouse monoclonal Di/Tri-Methyl-histone H3 (Lys9) Cell Signaling Technology Cat# 5327S; RRID: AB_10695295 Mouse monoclonal Anti-5-methylcytosine (5-mC) Abcam Cat# ab10805; RRID: AB_442823 Rabbit monoclonal Ezh2 Cell Signaling Technology Cat# 5246S; RRID: AB_10694683 Mouse monoclonal Anti-IDH1 R132H Dianova manufacture Cat# DIA-H09; RRID: AB_2335716 Mouse monoclonal PP1 (E 9) Santa Cruz Cat# 7482; RRID: AB_628177 Mouse monoclonal Phospho IkBa Cell signaling Cat# 9246; RRID: AB_22267145 Mouse monoclonal Anti-a-Tubulin Sigma Aldrich Cat# T6074; RRID:AB_477582 Rabbit monoclonal Anti-Histone H3 Abcam Cat# ab1791; RRID: AB_302613 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat# 7076; RRID:AB_330924 Anti-rabbit IgG, HRP-Linked Antibody Cell Signaling Cat# 7074; RRID:AB_2099233 Donkey anti-mouse IgG (H + L) Alexa FluorTM 594 Thermo Fisher/Invitrogen Cat# R37115; RRID:AB_2556543 Bacterial and virus strains Retroviral vector pLNCX2 Turcan et al.13 N/A Biological samples Diffuse glioma samples (Populations 1–7) This study Table S1 Chemicals, peptides, and recombinant proteins Plasmid Transfection Medium Santa Cruz Cat# sc-108062 Ultra-Cruz Transfection Reagent Santa Cruz Cat# sc-395739 Gibco Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL) Gibco Cat# 10131-027 TRIzol Reagent Invitrogen Cat# 15-596-018 Gibco Opti-MEM I Reduced Serum Medium, no phenol red Gibco Cat# 11-058-021 Lipofectamine 2000 Transfection Reagent Invitrogen Cat# 11668019 GenomicDNA MiniPrep Kit Sigma Aldrich Cat# G1N70-1KT Critical commercial assays TransAM NF-kB Activation Assays | Colorimetric Kits Active Motif Cat# 43296 Nuclear Extract Kit Active Motif Cat# 40010 EpiQuik Global Histone H3K27 Methylation Assay Kit Epigentek Cat# P-3020-96 D-2-Hydroxyglutarate Assay Kit (Colorimetric) Abcam Cat# ab211070 GenElute Genomic DNA miniprep kit Sigma Aldrich Cat# GN170 Deposited data Clinical, genetic marker data (Populations 1–7) This study Table S2 ChIP-sequencing data This study GEO accession # GSE222571 (Continued on next page) Cell Reports Medicine 4, 101082, June 20, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNA-sequencing data This study portal.gdc.cancer.gov RNA-sequencing data This study GEO accession #GSE223712 RNA-sequencing data Nagaraja et al.17 GEO accession #GSE126319 RNA-sequencing data Grasso et al.70 dbGaP study accession phs000900.v1.p1 DNA methylation data This study portal.gdc.cancer.gov DNA methylation signature raw data – RTOG 9802 This study Table S6 NFKBIA methylation raw data – RTOG 9802 This study Table S6 DNA methylation data De Souza et al.16 https://data.mendeley.com/datasets/ hx566mwxnm/ DNA methylation data Mazor et al.78 EGAS00001001255 DNA methylation data Mazor et al.79 EGAS00001001854 DNA methylation data Bai et al.80 EGAS00001001588 DNA copy number variation data This study portal.gdc.cancer.gov NFKBIA DNA CNV raw data – RTOG 9802 This study Table S6 NFKBIA DNA CNV raw data – Mayo This study Table S6 DNA copy number variation data Suzuki et al.3 EGAS00001001044 Sequencing data This study portal.gdc.cancer.gov NFKBIA sequencing raw data This study https://github.com/SharedExomes/ Prim_Recur_Glioma_NFKBIA_exomes Experimental models: Cell lines NHA (Normal human immortalized astrocytes) Parental Sonoda et al.81 N/A NHA IDH1 WT Turcan et al.13 N/A NHA IDH1 R132H Turcan et al.13 N/A NHA IDH1 WT/KO IkBa This study N/A NHA IDH1 R132H Mut/KO IkBa This study N/A Oligonucleotides Accell Human NFKBIA siRNA Dharmacon (Horizon) Cat# A-004765-13-0020 Accell Non-targeting Control siRNA Dharmacon (Horizon) Cat# D-001910-01-20 Primer: SLC16A3 Forward: ACGAAAAGTGGGTTGGTCAG Invitrogen Cat# custome Primer: SLC16A3 Reverse: CCCCAACAGACACAAGACCT Invitrogen Cat# custome Recombinant DNA IkB-a Double Nickase Plasmid (h) Santa Cruz Cat# sc-400034-NIC NFKBIA FISH probe Empire Genomics Cat# NFKBIA-20-OR Software and algorithms R The R project for Statistical Computing https://www.r-project.org/ R package DNAcopy 1.72.3 Olshen et al.82 https://bioconductor.org/packages/ release/bioc/html/DNAcopy.html R package conumee 1.9.0 N/A https://bioconductor.org/packages/ release/bioc/html/conumee.html R package RCircos 1.2.2 Zhang et al.83 https://cran.r-project.org/web/packages/ RCircos/index.html R package minifi 1.44.0 Aryee et al.84 https://www.bioconductor.org/packages/ release/bioc/html/minfi.html R package TCGAbiolinksGUI 1.23.0 https://www.biorxiv.org/ content/10.1101/147496v2.full https://www.bioconductor.org/packages/ release/bioc/html/TCGAbiolinksGUI.html (Continued on next page) e2 Cell Reports Medicine 4, 101082, June 20, 2023

    Transfection:

    Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal IkBa Cell Signaling Technology Cat# 4814S; RRID: AB_390781 Mouse monoclonal b-Actin Cell Signaling Technology Cat# 3700; RRID: AB_2242334 Rabbit monoclonal Tri-Methyl-Histone H3(Lys27) Cell Signaling Technology Cat# 9733S; RRID: AB_2616029 Mouse monoclonal Di/Tri-Methyl-histone H3 (Lys9) Cell Signaling Technology Cat# 5327S; RRID: AB_10695295 Mouse monoclonal Anti-5-methylcytosine (5-mC) Abcam Cat# ab10805; RRID: AB_442823 Rabbit monoclonal Ezh2 Cell Signaling Technology Cat# 5246S; RRID: AB_10694683 Mouse monoclonal Anti-IDH1 R132H Dianova manufacture Cat# DIA-H09; RRID: AB_2335716 Mouse monoclonal PP1 (E 9) Santa Cruz Cat# 7482; RRID: AB_628177 Mouse monoclonal Phospho IkBa Cell signaling Cat# 9246; RRID: AB_22267145 Mouse monoclonal Anti-a-Tubulin Sigma Aldrich Cat# T6074; RRID:AB_477582 Rabbit monoclonal Anti-Histone H3 Abcam Cat# ab1791; RRID: AB_302613 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat# 7076; RRID:AB_330924 Anti-rabbit IgG, HRP-Linked Antibody Cell Signaling Cat# 7074; RRID:AB_2099233 Donkey anti-mouse IgG (H + L) Alexa FluorTM 594 Thermo Fisher/Invitrogen Cat# R37115; RRID:AB_2556543 Bacterial and virus strains Retroviral vector pLNCX2 Turcan et al.13 N/A Biological samples Diffuse glioma samples (Populations 1–7) This study Table S1 Chemicals, peptides, and recombinant proteins Plasmid Transfection Medium Santa Cruz Cat# sc-108062 Ultra-Cruz Transfection Reagent Santa Cruz Cat# sc-395739 Gibco Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL) Gibco Cat# 10131-027 TRIzol Reagent Invitrogen Cat# 15-596-018 Gibco Opti-MEM I Reduced Serum Medium, no phenol red Gibco Cat# 11-058-021 Lipofectamine 2000 Transfection Reagent Invitrogen Cat# 11668019 GenomicDNA MiniPrep Kit Sigma Aldrich Cat# G1N70-1KT Critical commercial assays TransAM NF-kB Activation Assays | Colorimetric Kits Active Motif Cat# 43296 Nuclear Extract Kit Active Motif Cat# 40010 EpiQuik Global Histone H3K27 Methylation Assay Kit Epigentek Cat# P-3020-96 D-2-Hydroxyglutarate Assay Kit (Colorimetric) Abcam Cat# ab211070 GenElute Genomic DNA miniprep kit Sigma Aldrich Cat# GN170 Deposited data Clinical, genetic marker data (Populations 1–7) This study Table S2 ChIP-sequencing data This study GEO accession # GSE222571 (Continued on next page) Cell Reports Medicine 4, 101082, June 20, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNA-sequencing data This study portal.gdc.cancer.gov RNA-sequencing data This study GEO accession #GSE223712 RNA-sequencing data Nagaraja et al.17 GEO accession #GSE126319 RNA-sequencing data Grasso et al.70 dbGaP study accession phs000900.v1.p1 DNA methylation data This study portal.gdc.cancer.gov DNA methylation signature raw data – RTOG 9802 This study Table S6 NFKBIA methylation raw data – RTOG 9802 This study Table S6 DNA methylation data De Souza et al.16 https://data.mendeley.com/datasets/ hx566mwxnm/ DNA methylation data Mazor et al.78 EGAS00001001255 DNA methylation data Mazor et al.79 EGAS00001001854 DNA methylation data Bai et al.80 EGAS00001001588 DNA copy number variation data This study portal.gdc.cancer.gov NFKBIA DNA CNV raw data – RTOG 9802 This study Table S6 NFKBIA DNA CNV raw data – Mayo This study Table S6 DNA copy number variation data Suzuki et al.3 EGAS00001001044 Sequencing data This study portal.gdc.cancer.gov NFKBIA sequencing raw data This study https://github.com/SharedExomes/ Prim_Recur_Glioma_NFKBIA_exomes Experimental models: Cell lines NHA (Normal human immortalized astrocytes) Parental Sonoda et al.81 N/A NHA IDH1 WT Turcan et al.13 N/A NHA IDH1 R132H Turcan et al.13 N/A NHA IDH1 WT/KO IkBa This study N/A NHA IDH1 R132H Mut/KO IkBa This study N/A Oligonucleotides Accell Human NFKBIA siRNA Dharmacon (Horizon) Cat# A-004765-13-0020 Accell Non-targeting Control siRNA Dharmacon (Horizon) Cat# D-001910-01-20 Primer: SLC16A3 Forward: ACGAAAAGTGGGTTGGTCAG Invitrogen Cat# custome Primer: SLC16A3 Reverse: CCCCAACAGACACAAGACCT Invitrogen Cat# custome Recombinant DNA IkB-a Double Nickase Plasmid (h) Santa Cruz Cat# sc-400034-NIC NFKBIA FISH probe Empire Genomics Cat# NFKBIA-20-OR Software and algorithms R The R project for Statistical Computing https://www.r-project.org/ R package DNAcopy 1.72.3 Olshen et al.82 https://bioconductor.org/packages/ release/bioc/html/DNAcopy.html R package conumee 1.9.0 N/A https://bioconductor.org/packages/ release/bioc/html/conumee.html R package RCircos 1.2.2 Zhang et al.83 https://cran.r-project.org/web/packages/ RCircos/index.html R package minifi 1.44.0 Aryee et al.84 https://www.bioconductor.org/packages/ release/bioc/html/minfi.html R package TCGAbiolinksGUI 1.23.0 https://www.biorxiv.org/ content/10.1101/147496v2.full https://www.bioconductor.org/packages/ release/bioc/html/TCGAbiolinksGUI.html (Continued on next page) e2 Cell Reports Medicine 4, 101082, June 20, 2023

    Activation Assay:

    Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal IkBa Cell Signaling Technology Cat# 4814S; RRID: AB_390781 Mouse monoclonal b-Actin Cell Signaling Technology Cat# 3700; RRID: AB_2242334 Rabbit monoclonal Tri-Methyl-Histone H3(Lys27) Cell Signaling Technology Cat# 9733S; RRID: AB_2616029 Mouse monoclonal Di/Tri-Methyl-histone H3 (Lys9) Cell Signaling Technology Cat# 5327S; RRID: AB_10695295 Mouse monoclonal Anti-5-methylcytosine (5-mC) Abcam Cat# ab10805; RRID: AB_442823 Rabbit monoclonal Ezh2 Cell Signaling Technology Cat# 5246S; RRID: AB_10694683 Mouse monoclonal Anti-IDH1 R132H Dianova manufacture Cat# DIA-H09; RRID: AB_2335716 Mouse monoclonal PP1 (E 9) Santa Cruz Cat# 7482; RRID: AB_628177 Mouse monoclonal Phospho IkBa Cell signaling Cat# 9246; RRID: AB_22267145 Mouse monoclonal Anti-a-Tubulin Sigma Aldrich Cat# T6074; RRID:AB_477582 Rabbit monoclonal Anti-Histone H3 Abcam Cat# ab1791; RRID: AB_302613 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat# 7076; RRID:AB_330924 Anti-rabbit IgG, HRP-Linked Antibody Cell Signaling Cat# 7074; RRID:AB_2099233 Donkey anti-mouse IgG (H + L) Alexa FluorTM 594 Thermo Fisher/Invitrogen Cat# R37115; RRID:AB_2556543 Bacterial and virus strains Retroviral vector pLNCX2 Turcan et al.13 N/A Biological samples Diffuse glioma samples (Populations 1–7) This study Table S1 Chemicals, peptides, and recombinant proteins Plasmid Transfection Medium Santa Cruz Cat# sc-108062 Ultra-Cruz Transfection Reagent Santa Cruz Cat# sc-395739 Gibco Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL) Gibco Cat# 10131-027 TRIzol Reagent Invitrogen Cat# 15-596-018 Gibco Opti-MEM I Reduced Serum Medium, no phenol red Gibco Cat# 11-058-021 Lipofectamine 2000 Transfection Reagent Invitrogen Cat# 11668019 GenomicDNA MiniPrep Kit Sigma Aldrich Cat# G1N70-1KT Critical commercial assays TransAM NF-kB Activation Assays | Colorimetric Kits Active Motif Cat# 43296 Nuclear Extract Kit Active Motif Cat# 40010 EpiQuik Global Histone H3K27 Methylation Assay Kit Epigentek Cat# P-3020-96 D-2-Hydroxyglutarate Assay Kit (Colorimetric) Abcam Cat# ab211070 GenElute Genomic DNA miniprep kit Sigma Aldrich Cat# GN170 Deposited data Clinical, genetic marker data (Populations 1–7) This study Table S2 ChIP-sequencing data This study GEO accession # GSE222571 (Continued on next page) Cell Reports Medicine 4, 101082, June 20, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNA-sequencing data This study portal.gdc.cancer.gov RNA-sequencing data This study GEO accession #GSE223712 RNA-sequencing data Nagaraja et al.17 GEO accession #GSE126319 RNA-sequencing data Grasso et al.70 dbGaP study accession phs000900.v1.p1 DNA methylation data This study portal.gdc.cancer.gov DNA methylation signature raw data – RTOG 9802 This study Table S6 NFKBIA methylation raw data – RTOG 9802 This study Table S6 DNA methylation data De Souza et al.16 https://data.mendeley.com/datasets/ hx566mwxnm/ DNA methylation data Mazor et al.78 EGAS00001001255 DNA methylation data Mazor et al.79 EGAS00001001854 DNA methylation data Bai et al.80 EGAS00001001588 DNA copy number variation data This study portal.gdc.cancer.gov NFKBIA DNA CNV raw data – RTOG 9802 This study Table S6 NFKBIA DNA CNV raw data – Mayo This study Table S6 DNA copy number variation data Suzuki et al.3 EGAS00001001044 Sequencing data This study portal.gdc.cancer.gov NFKBIA sequencing raw data This study https://github.com/SharedExomes/ Prim_Recur_Glioma_NFKBIA_exomes Experimental models: Cell lines NHA (Normal human immortalized astrocytes) Parental Sonoda et al.81 N/A NHA IDH1 WT Turcan et al.13 N/A NHA IDH1 R132H Turcan et al.13 N/A NHA IDH1 WT/KO IkBa This study N/A NHA IDH1 R132H Mut/KO IkBa This study N/A Oligonucleotides Accell Human NFKBIA siRNA Dharmacon (Horizon) Cat# A-004765-13-0020 Accell Non-targeting Control siRNA Dharmacon (Horizon) Cat# D-001910-01-20 Primer: SLC16A3 Forward: ACGAAAAGTGGGTTGGTCAG Invitrogen Cat# custome Primer: SLC16A3 Reverse: CCCCAACAGACACAAGACCT Invitrogen Cat# custome Recombinant DNA IkB-a Double Nickase Plasmid (h) Santa Cruz Cat# sc-400034-NIC NFKBIA FISH probe Empire Genomics Cat# NFKBIA-20-OR Software and algorithms R The R project for Statistical Computing https://www.r-project.org/ R package DNAcopy 1.72.3 Olshen et al.82 https://bioconductor.org/packages/ release/bioc/html/DNAcopy.html R package conumee 1.9.0 N/A https://bioconductor.org/packages/ release/bioc/html/conumee.html R package RCircos 1.2.2 Zhang et al.83 https://cran.r-project.org/web/packages/ RCircos/index.html R package minifi 1.44.0 Aryee et al.84 https://www.bioconductor.org/packages/ release/bioc/html/minfi.html R package TCGAbiolinksGUI 1.23.0 https://www.biorxiv.org/ content/10.1101/147496v2.full https://www.bioconductor.org/packages/ release/bioc/html/TCGAbiolinksGUI.html (Continued on next page) e2 Cell Reports Medicine 4, 101082, June 20, 2023

    Methylation:

    Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal IkBa Cell Signaling Technology Cat# 4814S; RRID: AB_390781 Mouse monoclonal b-Actin Cell Signaling Technology Cat# 3700; RRID: AB_2242334 Rabbit monoclonal Tri-Methyl-Histone H3(Lys27) Cell Signaling Technology Cat# 9733S; RRID: AB_2616029 Mouse monoclonal Di/Tri-Methyl-histone H3 (Lys9) Cell Signaling Technology Cat# 5327S; RRID: AB_10695295 Mouse monoclonal Anti-5-methylcytosine (5-mC) Abcam Cat# ab10805; RRID: AB_442823 Rabbit monoclonal Ezh2 Cell Signaling Technology Cat# 5246S; RRID: AB_10694683 Mouse monoclonal Anti-IDH1 R132H Dianova manufacture Cat# DIA-H09; RRID: AB_2335716 Mouse monoclonal PP1 (E 9) Santa Cruz Cat# 7482; RRID: AB_628177 Mouse monoclonal Phospho IkBa Cell signaling Cat# 9246; RRID: AB_22267145 Mouse monoclonal Anti-a-Tubulin Sigma Aldrich Cat# T6074; RRID:AB_477582 Rabbit monoclonal Anti-Histone H3 Abcam Cat# ab1791; RRID: AB_302613 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat# 7076; RRID:AB_330924 Anti-rabbit IgG, HRP-Linked Antibody Cell Signaling Cat# 7074; RRID:AB_2099233 Donkey anti-mouse IgG (H + L) Alexa FluorTM 594 Thermo Fisher/Invitrogen Cat# R37115; RRID:AB_2556543 Bacterial and virus strains Retroviral vector pLNCX2 Turcan et al.13 N/A Biological samples Diffuse glioma samples (Populations 1–7) This study Table S1 Chemicals, peptides, and recombinant proteins Plasmid Transfection Medium Santa Cruz Cat# sc-108062 Ultra-Cruz Transfection Reagent Santa Cruz Cat# sc-395739 Gibco Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL) Gibco Cat# 10131-027 TRIzol Reagent Invitrogen Cat# 15-596-018 Gibco Opti-MEM I Reduced Serum Medium, no phenol red Gibco Cat# 11-058-021 Lipofectamine 2000 Transfection Reagent Invitrogen Cat# 11668019 GenomicDNA MiniPrep Kit Sigma Aldrich Cat# G1N70-1KT Critical commercial assays TransAM NF-kB Activation Assays | Colorimetric Kits Active Motif Cat# 43296 Nuclear Extract Kit Active Motif Cat# 40010 EpiQuik Global Histone H3K27 Methylation Assay Kit Epigentek Cat# P-3020-96 D-2-Hydroxyglutarate Assay Kit (Colorimetric) Abcam Cat# ab211070 GenElute Genomic DNA miniprep kit Sigma Aldrich Cat# GN170 Deposited data Clinical, genetic marker data (Populations 1–7) This study Table S2 ChIP-sequencing data This study GEO accession # GSE222571 (Continued on next page) Cell Reports Medicine 4, 101082, June 20, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNA-sequencing data This study portal.gdc.cancer.gov RNA-sequencing data This study GEO accession #GSE223712 RNA-sequencing data Nagaraja et al.17 GEO accession #GSE126319 RNA-sequencing data Grasso et al.70 dbGaP study accession phs000900.v1.p1 DNA methylation data This study portal.gdc.cancer.gov DNA methylation signature raw data – RTOG 9802 This study Table S6 NFKBIA methylation raw data – RTOG 9802 This study Table S6 DNA methylation data De Souza et al.16 https://data.mendeley.com/datasets/ hx566mwxnm/ DNA methylation data Mazor et al.78 EGAS00001001255 DNA methylation data Mazor et al.79 EGAS00001001854 DNA methylation data Bai et al.80 EGAS00001001588 DNA copy number variation data This study portal.gdc.cancer.gov NFKBIA DNA CNV raw data – RTOG 9802 This study Table S6 NFKBIA DNA CNV raw data – Mayo This study Table S6 DNA copy number variation data Suzuki et al.3 EGAS00001001044 Sequencing data This study portal.gdc.cancer.gov NFKBIA sequencing raw data This study https://github.com/SharedExomes/ Prim_Recur_Glioma_NFKBIA_exomes Experimental models: Cell lines NHA (Normal human immortalized astrocytes) Parental Sonoda et al.81 N/A NHA IDH1 WT Turcan et al.13 N/A NHA IDH1 R132H Turcan et al.13 N/A NHA IDH1 WT/KO IkBa This study N/A NHA IDH1 R132H Mut/KO IkBa This study N/A Oligonucleotides Accell Human NFKBIA siRNA Dharmacon (Horizon) Cat# A-004765-13-0020 Accell Non-targeting Control siRNA Dharmacon (Horizon) Cat# D-001910-01-20 Primer: SLC16A3 Forward: ACGAAAAGTGGGTTGGTCAG Invitrogen Cat# custome Primer: SLC16A3 Reverse: CCCCAACAGACACAAGACCT Invitrogen Cat# custome Recombinant DNA IkB-a Double Nickase Plasmid (h) Santa Cruz Cat# sc-400034-NIC NFKBIA FISH probe Empire Genomics Cat# NFKBIA-20-OR Software and algorithms R The R project for Statistical Computing https://www.r-project.org/ R package DNAcopy 1.72.3 Olshen et al.82 https://bioconductor.org/packages/ release/bioc/html/DNAcopy.html R package conumee 1.9.0 N/A https://bioconductor.org/packages/ release/bioc/html/conumee.html R package RCircos 1.2.2 Zhang et al.83 https://cran.r-project.org/web/packages/ RCircos/index.html R package minifi 1.44.0 Aryee et al.84 https://www.bioconductor.org/packages/ release/bioc/html/minfi.html R package TCGAbiolinksGUI 1.23.0 https://www.biorxiv.org/ content/10.1101/147496v2.full https://www.bioconductor.org/packages/ release/bioc/html/TCGAbiolinksGUI.html (Continued on next page) e2 Cell Reports Medicine 4, 101082, June 20, 2023

    Marker:

    Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal IkBa Cell Signaling Technology Cat# 4814S; RRID: AB_390781 Mouse monoclonal b-Actin Cell Signaling Technology Cat# 3700; RRID: AB_2242334 Rabbit monoclonal Tri-Methyl-Histone H3(Lys27) Cell Signaling Technology Cat# 9733S; RRID: AB_2616029 Mouse monoclonal Di/Tri-Methyl-histone H3 (Lys9) Cell Signaling Technology Cat# 5327S; RRID: AB_10695295 Mouse monoclonal Anti-5-methylcytosine (5-mC) Abcam Cat# ab10805; RRID: AB_442823 Rabbit monoclonal Ezh2 Cell Signaling Technology Cat# 5246S; RRID: AB_10694683 Mouse monoclonal Anti-IDH1 R132H Dianova manufacture Cat# DIA-H09; RRID: AB_2335716 Mouse monoclonal PP1 (E 9) Santa Cruz Cat# 7482; RRID: AB_628177 Mouse monoclonal Phospho IkBa Cell signaling Cat# 9246; RRID: AB_22267145 Mouse monoclonal Anti-a-Tubulin Sigma Aldrich Cat# T6074; RRID:AB_477582 Rabbit monoclonal Anti-Histone H3 Abcam Cat# ab1791; RRID: AB_302613 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat# 7076; RRID:AB_330924 Anti-rabbit IgG, HRP-Linked Antibody Cell Signaling Cat# 7074; RRID:AB_2099233 Donkey anti-mouse IgG (H + L) Alexa FluorTM 594 Thermo Fisher/Invitrogen Cat# R37115; RRID:AB_2556543 Bacterial and virus strains Retroviral vector pLNCX2 Turcan et al.13 N/A Biological samples Diffuse glioma samples (Populations 1–7) This study Table S1 Chemicals, peptides, and recombinant proteins Plasmid Transfection Medium Santa Cruz Cat# sc-108062 Ultra-Cruz Transfection Reagent Santa Cruz Cat# sc-395739 Gibco Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL) Gibco Cat# 10131-027 TRIzol Reagent Invitrogen Cat# 15-596-018 Gibco Opti-MEM I Reduced Serum Medium, no phenol red Gibco Cat# 11-058-021 Lipofectamine 2000 Transfection Reagent Invitrogen Cat# 11668019 GenomicDNA MiniPrep Kit Sigma Aldrich Cat# G1N70-1KT Critical commercial assays TransAM NF-kB Activation Assays | Colorimetric Kits Active Motif Cat# 43296 Nuclear Extract Kit Active Motif Cat# 40010 EpiQuik Global Histone H3K27 Methylation Assay Kit Epigentek Cat# P-3020-96 D-2-Hydroxyglutarate Assay Kit (Colorimetric) Abcam Cat# ab211070 GenElute Genomic DNA miniprep kit Sigma Aldrich Cat# GN170 Deposited data Clinical, genetic marker data (Populations 1–7) This study Table S2 ChIP-sequencing data This study GEO accession # GSE222571 (Continued on next page) Cell Reports Medicine 4, 101082, June 20, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNA-sequencing data This study portal.gdc.cancer.gov RNA-sequencing data This study GEO accession #GSE223712 RNA-sequencing data Nagaraja et al.17 GEO accession #GSE126319 RNA-sequencing data Grasso et al.70 dbGaP study accession phs000900.v1.p1 DNA methylation data This study portal.gdc.cancer.gov DNA methylation signature raw data – RTOG 9802 This study Table S6 NFKBIA methylation raw data – RTOG 9802 This study Table S6 DNA methylation data De Souza et al.16 https://data.mendeley.com/datasets/ hx566mwxnm/ DNA methylation data Mazor et al.78 EGAS00001001255 DNA methylation data Mazor et al.79 EGAS00001001854 DNA methylation data Bai et al.80 EGAS00001001588 DNA copy number variation data This study portal.gdc.cancer.gov NFKBIA DNA CNV raw data – RTOG 9802 This study Table S6 NFKBIA DNA CNV raw data – Mayo This study Table S6 DNA copy number variation data Suzuki et al.3 EGAS00001001044 Sequencing data This study portal.gdc.cancer.gov NFKBIA sequencing raw data This study https://github.com/SharedExomes/ Prim_Recur_Glioma_NFKBIA_exomes Experimental models: Cell lines NHA (Normal human immortalized astrocytes) Parental Sonoda et al.81 N/A NHA IDH1 WT Turcan et al.13 N/A NHA IDH1 R132H Turcan et al.13 N/A NHA IDH1 WT/KO IkBa This study N/A NHA IDH1 R132H Mut/KO IkBa This study N/A Oligonucleotides Accell Human NFKBIA siRNA Dharmacon (Horizon) Cat# A-004765-13-0020 Accell Non-targeting Control siRNA Dharmacon (Horizon) Cat# D-001910-01-20 Primer: SLC16A3 Forward: ACGAAAAGTGGGTTGGTCAG Invitrogen Cat# custome Primer: SLC16A3 Reverse: CCCCAACAGACACAAGACCT Invitrogen Cat# custome Recombinant DNA IkB-a Double Nickase Plasmid (h) Santa Cruz Cat# sc-400034-NIC NFKBIA FISH probe Empire Genomics Cat# NFKBIA-20-OR Software and algorithms R The R project for Statistical Computing https://www.r-project.org/ R package DNAcopy 1.72.3 Olshen et al.82 https://bioconductor.org/packages/ release/bioc/html/DNAcopy.html R package conumee 1.9.0 N/A https://bioconductor.org/packages/ release/bioc/html/conumee.html R package RCircos 1.2.2 Zhang et al.83 https://cran.r-project.org/web/packages/ RCircos/index.html R package minifi 1.44.0 Aryee et al.84 https://www.bioconductor.org/packages/ release/bioc/html/minfi.html R package TCGAbiolinksGUI 1.23.0 https://www.biorxiv.org/ content/10.1101/147496v2.full https://www.bioconductor.org/packages/ release/bioc/html/TCGAbiolinksGUI.html (Continued on next page) e2 Cell Reports Medicine 4, 101082, June 20, 2023

    ChIP-sequencing:

    Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal IkBa Cell Signaling Technology Cat# 4814S; RRID: AB_390781 Mouse monoclonal b-Actin Cell Signaling Technology Cat# 3700; RRID: AB_2242334 Rabbit monoclonal Tri-Methyl-Histone H3(Lys27) Cell Signaling Technology Cat# 9733S; RRID: AB_2616029 Mouse monoclonal Di/Tri-Methyl-histone H3 (Lys9) Cell Signaling Technology Cat# 5327S; RRID: AB_10695295 Mouse monoclonal Anti-5-methylcytosine (5-mC) Abcam Cat# ab10805; RRID: AB_442823 Rabbit monoclonal Ezh2 Cell Signaling Technology Cat# 5246S; RRID: AB_10694683 Mouse monoclonal Anti-IDH1 R132H Dianova manufacture Cat# DIA-H09; RRID: AB_2335716 Mouse monoclonal PP1 (E 9) Santa Cruz Cat# 7482; RRID: AB_628177 Mouse monoclonal Phospho IkBa Cell signaling Cat# 9246; RRID: AB_22267145 Mouse monoclonal Anti-a-Tubulin Sigma Aldrich Cat# T6074; RRID:AB_477582 Rabbit monoclonal Anti-Histone H3 Abcam Cat# ab1791; RRID: AB_302613 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Cat# 7076; RRID:AB_330924 Anti-rabbit IgG, HRP-Linked Antibody Cell Signaling Cat# 7074; RRID:AB_2099233 Donkey anti-mouse IgG (H + L) Alexa FluorTM 594 Thermo Fisher/Invitrogen Cat# R37115; RRID:AB_2556543 Bacterial and virus strains Retroviral vector pLNCX2 Turcan et al.13 N/A Biological samples Diffuse glioma samples (Populations 1–7) This study Table S1 Chemicals, peptides, and recombinant proteins Plasmid Transfection Medium Santa Cruz Cat# sc-108062 Ultra-Cruz Transfection Reagent Santa Cruz Cat# sc-395739 Gibco Geneticin Selective Antibiotic (G418 Sulfate) (50 mg/mL) Gibco Cat# 10131-027 TRIzol Reagent Invitrogen Cat# 15-596-018 Gibco Opti-MEM I Reduced Serum Medium, no phenol red Gibco Cat# 11-058-021 Lipofectamine 2000 Transfection Reagent Invitrogen Cat# 11668019 GenomicDNA MiniPrep Kit Sigma Aldrich Cat# G1N70-1KT Critical commercial assays TransAM NF-kB Activation Assays | Colorimetric Kits Active Motif Cat# 43296 Nuclear Extract Kit Active Motif Cat# 40010 EpiQuik Global Histone H3K27 Methylation Assay Kit Epigentek Cat# P-3020-96 D-2-Hydroxyglutarate Assay Kit (Colorimetric) Abcam Cat# ab211070 GenElute Genomic DNA miniprep kit Sigma Aldrich Cat# GN170 Deposited data Clinical, genetic marker data (Populations 1–7) This study Table S2 ChIP-sequencing data This study GEO accession # GSE222571 (Continued on next page) Cell Reports Medicine 4, 101082, June 20, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER RNA-sequencing data This study portal.gdc.cancer.gov RNA-sequencing data This study GEO accession #GSE223712 RNA-sequencing data Nagaraja et al.17 GEO accession #GSE126319 RNA-sequencing data Grasso et al.70 dbGaP study accession phs000900.v1.p1 DNA methylation data This study portal.gdc.cancer.gov DNA methylation signature raw data – RTOG 9802 This study Table S6 NFKBIA methylation raw data – RTOG 9802 This study Table S6 DNA methylation data De Souza et al.16 https://data.mendeley.com/datasets/ hx566mwxnm/ DNA methylation data Mazor et al.78 EGAS00001001255 DNA methylation data Mazor et al.79 EGAS00001001854 DNA methylation data Bai et al.80 EGAS00001001588 DNA copy number variation data This study portal.gdc.cancer.gov NFKBIA DNA CNV raw data – RTOG 9802 This study Table S6 NFKBIA DNA CNV raw data – Mayo This study Table S6 DNA copy number variation data Suzuki et al.3 EGAS00001001044 Sequencing data This study portal.gdc.cancer.gov NFKBIA sequencing raw data This study https://github.com/SharedExomes/ Prim_Recur_Glioma_NFKBIA_exomes Experimental models: Cell lines NHA (Normal human immortalized astrocytes) Parental Sonoda et al.81 N/A NHA IDH1 WT Turcan et al.13 N/A NHA IDH1 R132H Turcan et al.13 N/A NHA IDH1 WT/KO IkBa This study N/A NHA IDH1 R132H Mut/KO IkBa This study N/A Oligonucleotides Accell Human NFKBIA siRNA Dharmacon (Horizon) Cat# A-004765-13-0020 Accell Non-targeting Control siRNA Dharmacon (Horizon) Cat# D-001910-01-20 Primer: SLC16A3 Forward: ACGAAAAGTGGGTTGGTCAG Invitrogen Cat# custome Primer: SLC16A3 Reverse: CCCCAACAGACACAAGACCT Invitrogen Cat# custome Recombinant DNA IkB-a Double Nickase Plasmid (h) Santa Cruz Cat# sc-400034-NIC NFKBIA FISH probe Empire Genomics Cat# NFKBIA-20-OR Software and algorithms R The R project for Statistical Computing https://www.r-project.org/ R package DNAcopy 1.72.3 Olshen et al.82 https://bioconductor.org/packages/ release/bioc/html/DNAcopy.html R package conumee 1.9.0 N/A https://bioconductor.org/packages/ release/bioc/html/conumee.html R package RCircos 1.2.2 Zhang et al.83 https://cran.r-project.org/web/packages/ RCircos/index.html R package minifi 1.44.0 Aryee et al.84 https://www.bioconductor.org/packages/ release/bioc/html/minfi.html R package TCGAbiolinksGUI 1.23.0 https://www.biorxiv.org/ content/10.1101/147496v2.full https://www.bioconductor.org/packages/ release/bioc/html/TCGAbiolinksGUI.html (Continued on next page) e2 Cell Reports Medicine 4, 101082, June 20, 2023

    other:

    Article Title: Evaluation of Tazemetostat as a Therapeutically Relevant Substance in Biliary Tract Cancer
    Article Snippet: EZH2 , Cell Signaling , 5246S , D2C9 , High pH , rtu , Ultraview , Ventana.

    Article Title: Haploinsufficiency of NFKBIA reshapes the epigenome antipodal to the IDH mutation and imparts disease fate in diffuse gliomas.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER RNA-sequencing data This study portal.gdc.cancer.gov RNA-sequencing data This study GEO accession #GSE223712 RNA-sequencing data Nagaraja et al.17 GEO accession #GSE126319 RNA-sequencing data Grasso et al.70 dbGaP study accession phs000900.v1.p1 DNA methylation data This study portal.gdc.cancer.gov DNA methylation signature raw data – RTOG 9802 This study Table S6 NFKBIA methylation raw data – RTOG 9802 This study Table S6 DNA methylation data De Souza et al.16 https://data.mendeley.com/datasets/ hx566mwxnm/ DNA methylation data Mazor et al.78 EGAS00001001255 DNA methylation data Mazor et al.79 EGAS00001001854 DNA methylation data Bai et al.80 EGAS00001001588 DNA copy number variation data This study portal.gdc.cancer.gov NFKBIA DNA CNV raw data – RTOG 9802 This study Table S6 NFKBIA DNA CNV raw data – Mayo This study Table S6 DNA copy number variation data Suzuki et al.3 EGAS00001001044 Sequencing data This study portal.gdc.cancer.gov NFKBIA sequencing raw data This study https://github.com/SharedExomes/ Prim_Recur_Glioma_NFKBIA_exomes Experimental models: Cell lines NHA (Normal human immortalized astrocytes) Parental Sonoda et al.81 N/A NHA IDH1 WT Turcan et al.13 N/A NHA IDH1 R132H Turcan et al.13 N/A NHA IDH1 WT/KO IkBa This study N/A NHA IDH1 R132H Mut/KO IkBa This study N/A Oligonucleotides Accell Human NFKBIA siRNA Dharmacon (Horizon) Cat# A-004765-13-0020 Accell Non-targeting Control siRNA Dharmacon (Horizon) Cat# D-001910-01-20 Primer: SLC16A3 Forward: ACGAAAAGTGGGTTGGTCAG Invitrogen Cat# custome Primer: SLC16A3 Reverse: CCCCAACAGACACAAGACCT Invitrogen Cat# custome Recombinant DNA IkB-a Double Nickase Plasmid (h) Santa Cruz Cat# sc-400034-NIC NFKBIA FISH probe Empire Genomics Cat# NFKBIA-20-OR Software and algorithms R The R project for Statistical Computing https://www.r-project.org/ R package DNAcopy 1.72.3 Olshen et al.82 https://bioconductor.org/packages/ release/bioc/html/DNAcopy.html R package conumee 1.9.0 N/A https://bioconductor.org/packages/ release/bioc/html/conumee.html R package RCircos 1.2.2 Zhang et al.83 https://cran.r-project.org/web/packages/ RCircos/index.html R package minifi 1.44.0 Aryee et al.84 https://www.bioconductor.org/packages/ release/bioc/html/minfi.html R package TCGAbiolinksGUI 1.23.0 https://www.biorxiv.org/ content/10.1101/147496v2.full https://www.bioconductor.org/packages/ release/bioc/html/TCGAbiolinksGUI.html (Continued on next page) e2 Cell Reports Medicine 4, 101082, June 20, 2023

    Article Title: RNA m 6 A dynamics promote transcription and RNA stability of bivalent genes during iPSC-induced generation of human lung progenitors.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Dorsomorphin MedChem Express HY-13418A Retinoic acid (Vitamin A) Selleck Chemicals S1653 Polyethylenimine, Linear, MW 25000, Transfection Grade (PEI 25K) Polysciences 23966 VeZol Reagent Vazyme R411-02 actinomycin D Sigma-Aldrich A9415 RNAClean XP beads Beckman Coulter A63987 RiboLock RNase inhibitor Thermo Fisher Scientific EO0382 Pierce Protein A/G Magnetic Beads Thermo Fisher Scientific 88803 Proteinase K Invitrogen 25530049 sodium acetate Sigma-Aldrich S7899 linear acrylamide Thermo Fisher Scientific AM9520 AMPure XP beads Beckman Coulter A63881 IGEPAL CA-630 Sigma-Aldrich I8896 DNase Roche 0476728001 ChamQ SYBR qPCR Master Mix Vazyme Q311-03 Fetal Bovine Serum ExCell FSS500 IC FIX BUFFER Thermo Fisher Scientific 00-8222-49 Triton X-100 Sigma-Aldrich T8787-100ML Critical commercial assays Primescript RT reagent kit TAKARA RR037A NEB Next rRNA depletion kit NEB E7400L SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian TAKARA 634413 PolyATtract mRNA Isolation System III Promega Z5300 iDeal ChIP-seq for Histomes kit Diagenode C01010051 Deposited data picoMeRIP-seq (Raw and analyzed data) This paper GEO: GSE283697 SUZ12 ChIP-seq in human H1-hESC ENCODE ENCSR000ATS EZH2 ChIP-seq in human H1-hESC ENCODE ENCSR000ASY Human H3K27me3 ChIP-seq in HUES64 ENCODE ENCSR634MAK Human H3K27me3 ChIP-seq in endodermal cell ENCODE ENCSR273IYV Human H3K4me3 ChIP-seq in HUES64 ENCODE ENCSR894OYM Human H3K4me3 ChIP-seq in endodermal cell ENCODE ENCSR446ZCY RBM15B iCLIP-seq in HEK293T cell GEO GSM2064711 YTHDC1 ChIP-seq in human H1-hESC GEO GSM7029340 Experimental models: Cell lines Human peripheral blood mononuclear cell-derived iPSCs From Prof. Guangjin Pan (Guangzhou Institutes of Biomedicine and Health, Chinese Academy of Sciences) PB004 HEK293T ATCC CRL-3216 Oligonucleotides Primers for RT-qPCR, see Table S1 This paper N/A Primers for MeRIP-qPCR and RIP-qPCR, see Table S1 This paper N/A Primers for ChIP-qPCR, see Table S1 This paper N/A Primers for TBP, see Table S1 This paper N/A (Continued on next page) Cell Reports 44, 115802, June 24, 2025 19

    Blocking Assay:

    Article Title: LncRNA JPX targets SERCA2a to mitigate myocardial ischemia/reperfusion injury by binding to EZH2.
    Article Snippet: Long non-coding RNAs (lncRNAs) are pivotal regulators in heart disease, including myocardial ischemia/ reperfusion (I/R) injury.. LncRNA just proximal to XIST (JPX) is a molecular switch for X-chromosome inactivation.. Enhancer of zeste homolog 2 (EZH2) is a core catalytic subunit of the polycomb repressive complex 2 (PRC2), which is involved in chromatin compaction and gene repression.

    Incubation:

    Article Title: LncRNA JPX targets SERCA2a to mitigate myocardial ischemia/reperfusion injury by binding to EZH2.
    Article Snippet: Long non-coding RNAs (lncRNAs) are pivotal regulators in heart disease, including myocardial ischemia/ reperfusion (I/R) injury.. LncRNA just proximal to XIST (JPX) is a molecular switch for X-chromosome inactivation.. Enhancer of zeste homolog 2 (EZH2) is a core catalytic subunit of the polycomb repressive complex 2 (PRC2), which is involved in chromatin compaction and gene repression.

    Western Blot:

    Article Title: The microcephaly-associated transcriptional regulator AUTS2 cooperates with Polycomb complex PRC2 to produce upper-layer neurons in mice
    Article Snippet: Rabbit anti-FLAG 1:500 for immunoblotting , Sigma-Aldrich , F7425. .. Rabbit anti-EZH2 1:1000 for immunoblotting , Cell Signaling Technology , 5246S. .. Rabbit anti-SUZ12 1:1000 for immunoblotting , Cell Signaling Technology , 3737S.



    Similar Products

    96
    Cell Signaling Technology Inc rabbit anti ezh2
    Rabbit Anti Ezh2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5246s/Ezh2+XP+Rabbit+mAb/pm41888115-297-35-41
    Average 96 stars, based on 1 article reviews
    rabbit anti ezh2 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc ezh2
    Ezh2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5246s/Ezh2+XP+Rabbit+mAb/pmc13000541-9-0-4
    Average 96 stars, based on 1 article reviews
    ezh2 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc 5246t
    5246t, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5246s/Ezh2+XP+Rabbit+mAb/bio_rxiv__64898__2026__03__19__712957-153-22-21
    Average 96 stars, based on 1 article reviews
    5246t - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Cell Signaling Technology Inc anti ezh2
    Anti Ezh2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/5246s/Ezh2+XP+Rabbit+mAb/pm41785858-810-28-29
    Average 96 stars, based on 1 article reviews
    anti ezh2 - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    Image Search Results